Investigating Reciprocal Control of Adherence and Motility through the Lens of PapX, a Non-structural Fimbrial Repressor of Flagellar Synthesis.

[摘要] Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore it is logical to reciprocally regulate these functions. PapX, a non-structural protein encoded by the pheV- but not pheU-associated pap operon encoding the P fimbria adherence factor of E. coli CFT073, represses flagella-mediated motility and belongs to a highly conserved family of winged-helix transcription factors. Thus, when P fimbriae are synthesized for adherence, synthesis of flagella is repressed.The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains.To examine PapX structure-function, we generated papX linker-insertion and site-directed mutants, which identified two key residues for PapX function (Lys54 and Arg127) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. SELEX in conjunction with high-throughput sequencing was utilized for the first time to determine the unique binding site for the bacterial transcription factor PapX in E. coli CFT073.It was necessary to write and implement novel software for the analysis of the results from this technique.The software, TFAST, is freely available (Appendix C) and has near-perfect agreement (k = 0.89) to a gold standard in peak-finding software, MACS.Analysis of TFAST indicates that it correctly stratifies data to generate meaningful results, and successfully identified a 29 bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. PapX bound the flhD promoter in gel shift experiments, which was reversible with the 29 bp sequence, indicating that PapX binds directly to this site to repress transcription of flagellar genes. Microarray, qPCR and promoter fusions indicate that PapX is not transcriptionally regulated itself. Co-precipitation studies indicate that PapX likely requires at least one cofactor for its repressive activity, and OmpA was identified as a promising candidate.

[发布机构] University of Michigan

[效力级别] High throughput sequencing analysis software

[关键词] Reciprocal control of adherence and motility in E. coi;High throughput sequencing analysis software;Microbiology and Immunology;Science;Microbiology and Immunology